Work overview

Section 02 of 07

Materials and Methods

The Combined Administration of Rice Bran and Bacteria Producing Feruloyl Esterase Alleviates DSS‐Induced Ulcerative Colitis in Mice

Le Li, Feiyu Yang, Dan Shen, Jing Sun, Xinyi Pang, Yingjian Lu, and Xiangfei Li · 2026

Contents

Section 02 of 07

  1. 01Introduction
  2. 02Materials and Methods
  3. 03Results
  4. 04Discussion
  5. 05Author Contributions
  6. 06Funding
  7. 07Conflicts of Interest
Text size
Work overview

Section 2 of 7

Materials and Methods

Le Li, Feiyu Yang, Dan Shen, Jing Sun, Xinyi Pang, Yingjian Lu, and Xiangfei Li · about 8 minutes

Isolation and Screening of FAEb

MRS‐ethyl ferulate (EFA) solid medium was employed for the isolation and screening of FAEb. Briefly, 0.2 g of mouse fecal matter was dissolved in 2 mL of 0.9% NaCl solution, homogenized, and gradiently diluted before plating onto solid MRS‐EFA medium. The plates were incubated at 37°C for 72 h. Single colonies with larger transparent zones were selected and inoculated into MRS liquid medium for cultivation at 37°C. After screening, the strain L. johnsonii 23 with the highest FAE‐producing capacity was chosen, mixed with 30% glycerol solution, and stored at −80°C for future use.

16S rRNA Gene Sequencing Identification

16S rRNA gene sequencing was performed according to the method described by Shen (Shen et al. 2022). DNA was extracted from L. johnsonii using a bacterial genomic DNA extraction kit (Tiangen, Beijing, China). PCR amplification was conducted using the 16S rRNA universal primers 27 F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492 R (5′‐GGTTACCTTGTTACGACTT‐3′) with the extracted DNA as the template. The nucleotide sequences of the PCR products were determined by Sangon Biotech Co. Ltd. (Shanghai, China). The sequencing results were then input into the NCBI database (https://www.ncbi.nlm.nih.gov/) for comparison.

Preparation of Test Substances

L. johnsonii 23 was inoculated into MRS liquid medium and cultured at 37°C for 18 h. After 2 generations, the bacterial cells were collected by centrifugation at 8000 rpm for 10 min at 4°C, washed twice with sterile saline, and centrifuged again under the same conditions. The bacterial cells were then dissolved in 9% sterile physiological saline and diluted to 5 × 109 CFU/mL for subsequent animal experiments.

Animals and Experimental Design

48 healthy SPF‐grade male C57BL/6J mice aged 6–8 weeks (20 ± 2 g) were purchased from Shanghai SLAC Laboratory Animal Co. Ltd. (SCXK (HU) 2017–0005; Shanghai, China). The animal experimental protocol was approved by the Animal Ethics Committee of the Laboratory Animal Center of Nanjing Agricultural University (permit NO. NJAU. No20210317024) and conducted in accordance with the Regulations for the Administration of Laboratory Animals issued by the State Scientific and Technological Commission of the People's Republic of China. The mice were housed under standard conditions with a temperature of 22°C ± 2°C, relative humidity of 55% ± 5%, and a 12‐h light–dark cycle. They had free access to water and food. A one‐week adaptive feeding period was implemented before the start of the formal experiment.

The dosage of each intervention was determined based on previously reported colitis mouse studies and laboratory pre‐exploration. Briefly, sulfasalazine at 50 mg/kg was selected as the standard positive control dose for DSS‐induced colitis models (Axelsson et al. 1998; Shen et al. 2022). A 20% rice bran‐containing diet was chosen after preliminary feeding trials to balance feeding tolerance and intestinal protective efficacy (Weber et al. 2023). The concentration of L. johnsonii 23 suspension was set to 5 × 109 CFU/mL, which was verified to supply sufficient viable bacteria for feruloyl esterase secretion without causing gastrointestinal burden in mice (M. Li et al. 2022; Shen et al. 2022).

The animal experimental procedure is outlined in Figure 1A. 48 mice were randomly divided into seven groups of eight each: control group (CN), DSS group (MD), sulfasalazine group (PC), RB group (RB), L. johnsonii 23 group (L23), and RB + L. johnsonii 23 group (RL). Mice in the CN and MD groups were orally administered 0.4 mL of 0.85% sterile physiological saline daily. Mice in the PC group received 0.4 mL of sulfasalazine dissolved in 0.85% sterile physiological saline at a dose of 50 mg/kg daily. Mice in the RB group were orally administered 0.4 mL of 0.85% sterile physiological saline daily and fed a diet containing 20% RB. Mice in the L23 group were orally administered 0.4 mL of 5 × 109 CFU/mL L. johnsonii 23 suspension daily. Mice in the RL group received 0.4 mL of 5 × 109 CFU/mL L. johnsonii 23 suspension daily and were fed a diet containing 20% RB. All groups received sterile drinking water without DSS from days 1 to 13. From days 14 to 21, all groups except the CN group were given a 2% (w/v) DSS (MP Biomedicals LLC) aqueous solution, which was replaced every two days. Body weights of the mice were measured daily during the experiment.

FIGURE 1: Effects of combined intervention of RB and L. johnsonii 23 on UC in mice. (A) Design of animal experimental protocols. (B) Changes in body weight. (C) DAI index. (D) The colon length. (E) Colon length pictures. The data were expressed as mean ± SEM (n = 8). Mean values with different superscript letters are significantly different (p < 0.05).

FIGURE 1: Effects of combined intervention of RB and L. johnsonii 23 on UC in mice. (A) Design of animal experimental protocols. (B) Changes in body weight. (C) DAI index. (D) The colon length. (E) Colon length pictures. The data were expressed as mean ± SEM (n = 8). Mean values with different superscript letters are significantly different (p < 0.05).

Sample Collection and Processing

Upon completion of the experiment, mice were sacrificed via cervical dislocation after being weighed on the 22nd day. Blood samples were collected and allowed to stand for 15 min before centrifugation at 4°C and 12,000 rpm for 10 min. The supernatant serum was then aspirated for subsequent biochemical analysis. Immediately, the liver, spleen, and kidneys were collected and weighed, and the organ index was calculated using the formula: Organ Index (mg/g) = Organ Weight (mg)/Body Weight (g). The colon was excised, its length measured, and photographed. A 1‐cm colon section was fixed in 4% paraformaldehyde at room temperature and subsequently stained. A 100‐mg colon sample was dissolved in 900 μL of sterile physiological saline, homogenized using a frozen tissue grinder, and centrifuged at 4°C and 12,000 rpm for 10 min. The supernatant was collected for biochemical marker detection. Contents of the cecum were immediately frozen in liquid nitrogen for further analysis.

DAI Scoring

Disease activity was monitored daily from Day 15 to 21 of the experiment. DAI scores were assigned based on body weight loss, stool characteristics, and rectal bleeding using the criteria outlined in Table 1. The DAI was calculated using the formula: (Body Weight Loss Score + Stool Characteristics Score + Rectal Bleeding Score)/3.

Indicators | CN | MD | PC | RB | L23 | RL
Liver (mg/g) | 38.38 ± 2.77a | 40.35 ± 1.69a | 39.37 ± 2.48a | 39.64 ± 2.83a | 40.25 ± 4.84a | 39.49 ± 3.33a
Spleen (mg/g) | 2.56 ± 0.50a | 5.04 ± 1.36c | 3.45 ± 0.37b | 2.87 ± 0.43ab | 3.54 ± 0.62b | 3.47 ± 0.68b
Kidney (mg/g) | 12.9 ± 0.81a | 12.37 ± 0.77a | 12.32 ± 0.66a | 12.3 ± 1.12a | 12.59 ± 1.20a | 12.49 ± 0.55a

Biochemical Indices Determination

The concentrations of malondialdehyde (MDA), superoxide dismutase (SOD), glutathione (GSH), and glutathione peroxidase (GSH‐PX) in colon homogenates were measured using enzyme‐linked immunosorbent assay (ELISA) kits obtained from Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). Serum concentrations of interleukin‐1β (IL‐1β), IL‐6, IL‐10, and tumor necrosis factor‐α (TNF‐α) were determined using ELISA kits.

Histological Analysis

Colon tissues were fixed in 4% paraformaldehyde for 24 h, rinsed with ultrapure water to remove the fixative, dehydrated in a graded series of ethanol solutions, and cleared in xylene. The colon tissue sections were embedded in paraffin, cut into 4‐μm slices, and stained with hematoxylin and eosin (HE) as well as Alcian blue and Periodic acid‐Schiff (AB‐PAS). For AB‐PAS staining, colon sections were dewaxed and washed, stained with Alcian blue for 10 min and washed, stained with periodic acid for 5 min and washed, stained with Schiff's reagent for 10 min and washed, dehydrated in ethanol, cleared in xylene, and sealed with neutral glue. All sections were observed under an Olympus microscope (Tokyo, Japan).

Determination of SCFAs in Cecal Contents

Cecal contents were collected into 2‐mL sterile centrifuge tubes. A 500‐μL aliquot of saturated NaCl solution was added to dissolve and homogenize the contents. Then, 20 μL of 10% sulfuric acid was added for acidification, and the mixture was vortexed for 30 s. Subsequently, 800 μL of ether was added, and the mixture was vortexed for another 30 s. The solution was centrifuged at 4°C and 14,000 rpm for 15 min, and the supernatant was collected into a 2 mL centrifuge tube containing 0.25 g of anhydrous Na2SO4 (drying agent) for incubation for 10 min. After centrifugation under the same conditions, the supernatant was collected, filtered through a 0.22‐μm organic membrane, and analyzed using gas chromatography–mass spectrometry (GC–MS). GC–MS conditions were as follows: Rtx‐Wax column (30 m × 0.25 mm × 0.25 μm); helium carrier gas flow rate of 2 mL/min; injection volume of 1 μL; split ratio of 10:1; ion source temperature of 220°C; and inlet temperature of 240°C. The temperature program used was as follows: initial temperature of 100°C; increased to 140°C at a rate of 7.5°C/min; increased to 200°C at a rate of 60°C/min; and maintained for 3 min. The concentrations of each SCFA (μmol/g) were calculated using the external standard method in full scan mode.

Statistical Analysis

All data are expressed as mean ± standard error of the mean (SEM). The one‐way analysis of variance (ANOVA) was used to analyze all data, followed by Duncan's multiple range test. A p‐value < 0.05 was considered statistically significant. Graphical presentations were performed using Origin 9.0 software (OriginLab Corporation, Northampton, MA), and all statistical analyses were conducted using SPSS 16.0 software (SPSS, Chicago, IL).