Work overview

Section 08 of 08

STAR★Methods

STING agonist profiling by nucleotide library defines structural determinants of cyclic dinucleotide recognition

Indra Bekere, Yuliia Hubarzhevska, Sabrina V. Egender, Patrick K. Quoika, Rupert Öllinger, Marie Rose Schrimpf, Roland Rad, Martin Zacharias, and Carina C. de Oliveira Mann · 2026

Contents

Section 08 of 08

  1. 01Introduction
  2. 02Results
  3. 03Discussion
  4. 04Resource availability
  5. 05Acknowledgments
  6. 06Author contributions
  7. 07Declaration of interests
  8. 08STAR★Methods
Text size
Work overview

Section 8 of 8

STAR★Methods

Indra Bekere, Yuliia Hubarzhevska, Sabrina V. Egender, Patrick K. Quoika, Rupert Öllinger, Marie Rose Schrimpf, Roland Rad, Martin Zacharias, and Carina C. de Oliveira Mann · about 14 minutes

Key resources table

REAGENT or RESOURCE | SOURCE | IDENTIFIER
Antibodies

rabbit monoclonal anti-STING | Cell Signaling | Cat#13647; RRID: AB_2732796
rabbit polyclonal anti-RPS19 | Thermo Fisher Scientific | Cat#A304-002 A; RRID: AB_2620351

Bacterial and virus strains

E. coli Rosetta | Expression Systems | N/A
E. coli STBL3 | Andreas Pichlmair | N/A
E. coli DH5alpha | Andreas Pichlmair | N/A

Chemicals, peptides, and recombinant proteins

Nucleotide library | See Table S1 | N/A
PEI | Polysciences | Cat#24765
cOmplete protease inhibitor, EDTA free | Roche | Cat#04693132001
YOYO-3 | Thermo Fisher Scientific | Cat#Y3606
SYPRO Orange | Sigma-Aldrich | Cat#S5692-50UL
Maxima RT Polymerase | Thermo Fisher Scientific | Cat# EP0753
Ni-NTA agarose | Macherey Nagel | Cat#745400.100

Critical commercial assays

LIVE/DEAD Cell Imaging Kit (488/570) | Thermo Fisher Scientific | Cat#R37601
PrimerScript RT (gDNA Eraser) | Takara | Cat#RR047B
Neon Transfection kit | Thermo Fisher Scientific | Cat#MPK1096; Cat# MPK10096
NucleoSpin RNA Plus kit | Macherey Nagel | Cat#740984.250
PowerUp™ SYBR™ Green Master Mix | Applied Biosystems Thermofisher | Car#A25776
Ultra II FS kit | NEB | Cat# E7805L
SuperSignal West Femto kit | Thermo Fisher Scientific | Cat#34096

Deposited data

RNA-seq | This paper | ENA: PRJEB102862
Human STING MD Simulation | This paper | Mendeley: https://doi.org/10.17632/fzjk6ttfmc.1
Unprocessed WB, gel and microscopy data | This paper | Mendeley: https://doi.org/10.17632/fzjk6ttfmc.1

Experimental models: Cell lines

THP-1 | Veit Hornung | N/A
HEK293T | ATCC | Cat#CRL-11268
mPC 53074 | Roland Rad | N/A
THP-1 NTC KO | This paper | N/A
THP-1 STING KO | This paper | N/A
HPAC | Roland Rad | RRID:CVCL_3517
PANC1 | Roland Rad | RRID:CVCL_0480
DANG | Roland Rad | RRID:CVCL_0243
DANG NTC KO | This paper | N/A
DANG STING KO | This paper | N/A

Oligonucleotides

STING KO gRNA1: CGGTCGGCCCGCCCTTCACT | This paper | N/A
STING KO gRNA2: GGGAATTTCAACGTGGCCCA | This paper | N/A
NTC KO gRNA1: CGACGGAGGCTAAGCGTCGCAA | This paper | N/A
NTC KO gRNA2: CGCGCTTCCGCGGCCCGTTCAA | This paper | N/A
Primers for RT-qPCR, see Table S2 | This paper | N/A

Recombinant DNA

pLentiCRISPRv2 (puromycin) | Sanjana et al.125 | Addgene Plasmid #52961
pMD2-VSVG | Andreas Pichlmair126 | N/A
pCMV-Gag-Pol | Andreas Pichlmair126 | N/A
Human STING 139–379 pET28M-SUMO | This paper | N/A
Human STING 139–379 E260Q pET28M-SUMO | This paper | N/A
Human STING 139–379 E260D pET28M-SUMO | This paper | N/A

Software and algorithms

Amber22 | Case at al.127 | https://ambermd.org/
AlphaFold3 | Abramson et al.128 | https://alphafoldserver.com
Drop-seq pipeline (v1.12) | Macosko et al.129 | https://cumulus.readthedocs.io/en/latest/drop_seq.html
Fiji (ImageJ 2.9.0) | Schindelin et al.130 | https://imagej.net/software/fiji/
Incucyte S3 software | Sartorius | N/A
DESeq2 1.42.1 | Love at al.131 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html
limma 3.58.1 | Ritchie et al.132 | https://bioconductor.org/packages/release/bioc/html/limma.html
ggplot2 3.4.4 | https://ggplot2.tidyverse.org | https://cran.r-project.org/web/packages/ggplot2/index.html
RStudio 2024.09.1 + 394 | Posit | https://posit.co/download/rstudio-desktop/
HOMER | Heinz et al.133 | http://homer.ucsd.edu/homer/
SnapGene | SnapGene | https://www.snapgene.com
UCSF ChimeraX 1.9rc20241121025 | Meng et al.134 | https://www.cgl.ucsf.edu/chimerax/index.html
Prism 10 | GraphPad Software | https://www.graphpad.com

Experimental model and study participant details

Escherichia coli strains

E. coli DH5alpha was used for cloning. E. coli STBL3 was used for cloning for plasmids used for lentivirus generation. E. coli Rosetta was used for recombinant protein expression.

Mammalian cell lines

THP-1 wild type, THP-1 NTC KO (this study) and THP-1 STING KO (this study) cells were cultured in suspension in RPMI supplemented with 10% FBS at 37°C in 5% CO2 and passaged at dilution 1:10. THP-1 cells were a kind gift from Prof. Veit Hornung (Gene Center Munich). Pancreatic cancer (PDAC) cell lines DANG, HPAC and PANC1 and mouse pancreatic cancer (mPC) 53704 were a kind gift from Prof. Roland Rad (TUM, Munich). PDAC cell lines DANG, HPAC and PANC1, DANG STING KO (this study), DANG NTC KO (this study) and HEK293T cells (ATCC Cat#CRL-11268) were cultured in DMEM supplemented with 10% FBS at 37°C in 5% CO2 and passaged at a dilution 1:5 - 1:10 by washing with PBS and detached with 0.25% trypsin. All cell lines were regularly tested negative for mycoplasma contamination using TaKaRA PCR Mycoplasma Detection Set (TaKaRa).

Method details

Protein expression and purification

Human STING C-terminal ligand binding domain (amino acids 139–379) wild-type, E260Q and E260D mutants were cloned into a pET-SUMO vector with N-terminal His-tag. For the expression plasmids were transformed into E. coli Rosetta and a 40 mL pre-culture in LB medium supplemented with Kanamycin (50 mg/L) and Chloramphenicol (34 mg/L) was grown at 37 °C, shaking overnight. The next day 10 mL of the pre-culture was used to inoculate 1 L of TB medium supplemented with Kanamycin (50 mg/L) and Chloramphenicol (34 mg/L) and was grown to OD600 = 0.9. The expression was induced by adding IPTG (1 mM) and the culture was further grown overnight at 18°C shaking. The cell pellet was harvested by centrifugation and flash frozen in liquid nitrogen. For purification cell pellet was thawed on ice and resuspended in lysis buffer (20 mM HEPES pH 7.5, 400 mM NaCl, 10% Glycerol, 30 mM Imidazole, 1× protease inhibitor (100 mM PMSF, 200 mM benzamidine, 200 μM pepstatin A, 60 μM leupeptin), 1 mM β-mercaptoethanol) and lysed by sonication. The soluble fraction was cleared by centrifugation and used for purification by Ni-affinity chromatography using Ni-NTA agarose (Macherey Nagel) with wash buffer (20 mM HEPES pH 7.5, 1 M NaCl, 10% Glycerol, 30 mM Imidazole, 1× protease inhibitor (100 mM PMSF, 200 mM benzamidine, 200 μM pepstatin A, 60 μM leupeptin), 1 mM β-mercaptoethanol) and elution buffer (20 mM HEPES pH 7.5, 400 mM NaCl, 10% Glycerol, 300 mM Imidazole, 1× protease inhibitor (100 mM PMSF, 200 mM benzamidine, 200 μM pepstatin A, 60 μM leupeptin), 1 mM β-mercaptoethanol). Afterwards, the His-SUMO tag was removed by proteolytic cleavage with SenP2 protease (1:250) (in-house production) during dialysis overnight in buffer containing 20 mM HEPES pH 7.5, 250 mM NaCl, 1 mM TCEP. Proteins were further purified by size-exclusion chromatography with a HiLoad 16/600 Superdex 75 pg (Cytiva) column in 20 mM HEPES pH 7.5, 250 mM NaCl, 1 mM TCEP buffer. Purified STING constructs were concentrated, flash frozen in liquid nitrogen and stored at −80°C.

In vitro thermal shift assays

For the analysis of STING C-terminal ligand binding domain (amino acids 139–379) wild-type with different CDNs protein was used at a final concentration of 5 μM with a 4× excess of nucleotides and SYPRO Orange dye (Sigma-Aldrich) at a final concentration of 2.5×. The experiment was performed in a buffer with the final concentration of 80 mM NaCl, 0.2 mM TCEP, 0.6 mM DTT and 20 mM HEPES pH 7.5. Samples were measured with Gain 2 and a melting curve ranging from 25°C to 95°C using qTOWER Iris qPCR device (Analytik Jena). Data were analyzed using qTOWER Iris software (Analytik Jena).

For the analysis of STING C-terminal ligand binding domain (amino acids 139–379) wild-type, E260Q and E260Q protein was used at a final concentration of 5 μM protein per well and SYPRO Orange (Sigma-Aldrich) at a final concentration of 1×. The experiment was performed in a buffer with the final concentration of 55 mM NaCl, 0.7 mM TCEP, 6% glycerol and 20 mM HEPES pH 7.5. Samples were measured with Gain 2 and a melting curve ranging from 5°C to 75°C using qTOWER Iris qPCR device (Analytik Jena). Data were analyzed using qTOWER Iris software (Analytik Jena).

Molecular dynamics simulations

The structure of the human STING dimer in complex with the 2′3′-cUAMP (pdb: 8gjz) served as a starting and reference structure. Missing residues in the crystal structure were added using AlphaFold3.128 Structural models of the complex with 2′3′cAUMP and other CDNs were generated after the best superposition of the sugar phosphate backbone on the reference structure and energy minimization to remove any residual sterical strain. All energy minimization and MD simulations were performed using the Amber22 package.127 The parm19SB force field was used for the protein and the Gaff force field135 was used to model the ligands. The STING complexes were solvated in octahedral boxes with explicit OPC water molecules136 keeping a minimum distance of 12 Å between protein atoms and box boundaries. The ion concentration was adjusted to 0.15 M with sodium and chloride ions. The simulation systems were energy minimized (5000 steps) after solvation followed by heating up to 300 K in steps of 100 K with positional restraints on all heavy atoms of the proteins. Subsequently, positional restraints were gradually removed from an initial 10 kcal・mol−1・Å−2 to 0.5 kcal・mol−1・Å−2 within 0.5 ns. In each case 3 independent production simulations of 50 ns with different random seeds for a Langevin thermostat (300 K) were performed at a temperature of 300 K and a pressure of 1 bar. The hydrogen mass repartition option of Amber was used to allow for a time step of 4 fs.137 The mean interaction energy between ligand and STING was calculated for each trajectory using the MMGBSA method as implemented in the Amber22 package (igb = 5 option) averaged over 250 trajectory frames. Averages and errors of the mean were obtained from 3 independent runs per bound CDN.

Generation of cell lines

Two different gRNA sequences for STING and non-targeting control (NTC) knockout were cloned in pLentiCRISPRv2 vector (Addgene #52961125) with puromycin resistance. Guide RNA sequences were STING gRNA1 CGGTCGGCCCGCCCTTCACT, STING gRNA2 GGGAATTTCAACGTGGCCCA, NTC gRNA1 CGACGGAGGCTAAGCGTCGCAA, NTC gRNA2 CGCGCTTCCGCGGCCCGTTCAA. Primers encoding target guide RNA sequences were annealed and used for ligation with linearized vector from restriction digest with BsmbI enzyme (NEB). Successful cloning was verified by sequencing and target vectors were further used for lentivirus generation.

Lentiviral transductions were used to generate THP-1 STING KO, THP-1 NTC KO, DANG STING KO and DANG NTC KO cell lines. For knockout generation lentiviral particles were generated by transfecting HEK293T cells using PEI transfection reagent (Polysciences) with pCMV-Gag-Pol126 and pMD2-VSVG126 packaging plasmids together with pLentiCRISPRv2 vector with puromycin resistance encoding S. pyogenes CRISPR-Cas9 and two different gRNA sequences. pCMV-Gag-Pol and pMD2-VSVG plasmids were kindly provided by Prof. Andreas Pichlmair (TUM, Munich). Lentiviral particles were harvested 48 h post transfection and used to transduce THP-1 and DANG cells followed by selection with 1.5 μg/mL and 1.0 μg/mL puromycin one day post infection, respectively. Selection was terminated once there were no more viable control untransduced cells with puromycin selection. Successful KO was validated by WB analysis.

Western blot analysis

For validation of STING KO in THP-1 and DANG cells, cells were lysed in NP-40 lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% NP-40, 5 mM EDTA) supplemented with 1× cOmplete protease inhibitor (Sigma-Aldrich) for 20-30min on ice. Soluble fraction was separated by centrifugation for 10min, 21′000xg, 4°C, mixed with 1× Laemmli sample buffer and boiled for 5-10min at 95°C. Protein was resolved by 12% SDS-PAGE and transferred to 0.45 μm PVDF membrane. Membranes were blocked in 5% non-fat dry milk, 0.1% Tween 20 in PBS and incubated with the following primary antibodies: anti-STING (Cell Signaling, #13647, 1:1000 dilution), anti-RPS19 (Thermo Fisher, #A304-002 A, 1:2000 dilution). Afterwards membranes were probed with HRP-conjugated secondary antibody goat anti-rabbit IgG (Dako, P0448). Immunoblots with HRP signal were developed with the SuperSignal West Femto kit (Thermo Fisher Scientific) and imaged with the Bio-Rad ChemiDoc Imaging System or Vilber Fusion FX6 Edge V0.7 Imaging System.

Electroporation of nucleotides

The nucleotide library consists of compounds synthesized and quality-controlled by Biolog LSI. All nucleotides are commercially available from Biolog LSI, and their corresponding catalog numbers are provided in Table S1.

Electroporation was performed with Neon Transfection kit (Thermo Fisher Scientific) following manufacturer’s instructions. THP-1 cells were collected and washed with PBS and resuspended in Buffer R to a final density of 5 × 106 cells/mL with 600 nM of nucleotides if not indicated otherwise. For electroporation 5 × 105 cells were used with 100 μL Neon tip and electroporated with pulse voltage 1400 V, pulse width 20 m s and pulse number 2 in 3 mL E2 Electrolyte Buffer. Afterwards cells were transferred to 1 mL pre-warmed RPMI, 10% FBS media in a 24 well plate and incubated at 37°C in 5% CO2 for 6 h until harvest.

For cell death analysis with the nucleotide library DANG cells were detached, washed with PBS and resuspended in Buffer R to a final density of 1.5 × 106 cells/mL with 2 μM of nucleotides. Cells were electroporated with 10 μL tip with pulse voltage 1400 V, pulse width 20 m s and pulse number 1 in 3 mL E Electrolyte Buffer. Afterwards cells were transferred to a well in a 96-well plate filled with DMEM, 10% FBS and 250 nM YOYO-3 (Thermo Fisher Scientific) cell death dye. Cell death was monitored using live cell imaging system Incucyte S3 (Sartorius) over 70 h with scans every 2 h. Cell death was quantified as red signal vs. phase.

For electroporation of mPC 53074 cells, cells were washed with PBS and resuspended in Buffer R to a final density of 6 × 106 cells/mL with 1 μM of nucleotides. Cells were electroporated with 100 μL tip with pulse voltage 1400 V, pulse width 20 m s and pulse number 2 in 3 mL E2 Electrolyte Buffer. Afterwards cells were transferred to a well in a 12-well plate filled with 1 mL DMEM, 10% FBS for 6 h until harvest.

DANG, HPAC, PANC1, DANG NTC KO and DANG STING KO cells for analysis of cell death and IFNB1 and CXCL10 expression levels were electroporated using Lonza 4D-Nucleofector X-unit (Lonza). Cells were washed with PBS and resuspended in electroporation buffer (120 mM Na2HPO4/NaH2PO4 (pH 7.2), 5 mM KCl, 15 mM MgCl2) to a final density 10 × 106 cells/mL with 2 μM of nucleotides. Cells were electroporated in 20 μL-well strips with pulse code EN150 (DANG, HPAC) and CM137 (PANC1). For RT-qPCR analysis cells from one well were seeded in a 12-well plate filled with 1 mL DMEM, 10% FBS for 5 h until harvest. For cell death analysis one-eighth of cells from one well in 20 μL-well strips were seeded in 100 μL DMEM, 10% FBS in one well in a 96-well plate for 24 h until cell death analysis using LIVE/DEAD Cell Imaging Kit (488/570) (Thermo Fisher Scientific) following manufacturers’ instructions. For cell death analysis cells were imaged using EVOS M500 fluorescence microscope and cell death was quantified as area of green (live cells) versus red (dead cells) fluorescence using Fiji (ImageJ 2.9.0) software.130

RT-qPCR analysis

Total RNA was extracted using the NucleoSpin RNA Plus kit (Macherey-Nagel) according to the manufacturers’ protocol. Total RNA was used for reverse transcription with PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa) according to the manufacturers' instructions. Relative transcript quantification was obtained by qPCR with the transcript-specific primers (Table S2) using PowerUp SYBR Green master mix (Thermo Fisher) on a QuantStudio3 PCR system (Thermo Fisher) or a qTOWER Iris qPCR device (Analytik Jena). Ct values were obtained using the QuantStudio or qTOWER Iris software and averaged across technical replicates. The transcript levels were normalized to the levels of a housekeeping gene GAPDH (human) or R_plp_0 (mouse). The oligonucleotides used for the analysis in human THP-1, DANG, PANC1 and HPAC cells were: IFNB1 forward ACGCCGCATTGACCATCTAT, IFNB1 reverse GTCTCATTCCAGCCAGTGCTA, CXCL10 forward AAGTGGCATTCAAGGAGTACCT, CXCL10 reverse GGACAAAATTGGCTTGCAGGA, GAPDH forward GATTCCACCCATGGCAAATTC, GAPDH reverse AGCATCGCCCCACTTGATT. The oligonucleotides used for the analysis in mouse pancreatic cancer 53074 cells were: Rplp0 forward GGATCTGCTGCATCTGCTTG, Rplp0 reverse GCGACCTGGAAGTCCAACTA, Ifnb1 forward CGGAGAAGATGCAGAAGAGT, Ifnb1 reverse TCAAGTGGAGAGCAGTTGAG.

RNA-seq library preparation, sequencing and data processing

Library preparation for bulk-sequencing of poly(A)-RNA was done as described previously.138 Barcoded cDNA of each sample was generated with a Maxima RT polymerase (Thermo Fisher) using oligo-dT primer containing barcodes, unique molecular identifiers (UMIs) and an adaptor. 5′ Ends of the cDNAs were extended by a template switch oligo (TSO) and full-length cDNA was amplified with primers binding to the TSO-site and the adaptor. NEB Ultra II FS kit was used to fragment cDNA. After end repair and A-tailing a TruSeq adapter was ligated and 3′-end-fragments were finally amplified using primers with Illumina P5 and P7 overhangs. The library was sequenced on a NextSeq1000 (Illumina) with 65 cycles for the cDNA in read1 and 19 cycles for the barcodes and UMIs in read2. Data was processed using the published Drop-seq pipeline (v1.12) to generate sample- and gene-wise UMI tables.129 Reference genome (GRCh38) was used for alignment. Transcript and gene definitions were used according to GENCODE v38.

Raw counts were used for differential expression analysis with DESeq2 (v1.42.1) package.131 For plotting of PCA plots and heatmaps counts were transformed using variance-stabilized transformation. Differentially expressed genes were defined as log2 fold change ≤ −1 or ≥ +1 and adjusted p value ≤0.05. Pathway analysis was performed using DAVID analysis tool.139

Transcription factor (TF) motif analysis

TF motif enrichment for known motifs was performed using HOMER package.133 Command findMotifs.pl was used and a list of gene symbols was supplied as an input. Motifs were searched in the region 400 bp upstream and 100 bp downstream of the TSS by specifying parameters -start -400 -end 100. For presentation of enriched TF motifs results from known motifs were used.

Quantification and statistical analysis

Statistical significance was calculated as indicated in Figure Legends and represented as ns p > 0.05, ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001, and ∗∗∗∗ p ≤ 0.0001 using GraphPad Prism 10.3.1. and RStudio 2024.09.1 + 394.