MATERIALS AND METHODS

Ethical approval

All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of National Chung Hsing University, Taichung, Taiwan, under permit number 99-83. The study was conducted in accordance with institutional animal welfare regulations, relevant international guidelines for laboratory animal care and use, and the ARRIVE 2.0 guidelines. All efforts were made to minimize animal suffering and reduce the number of animals used, in accordance with the principles of Replacement, Reduction, and Refinement. Animals were maintained under controlled housing conditions, acclimatized before experimentation, and handled by trained personnel. Sample collection was performed using standardized procedures, and biological pooling was applied to obtain sufficient material for proteomic analysis while limiting unnecessary animal use.

Study period and location

The study was conducted in the Department of Animal Science and the iEGG and Animal Biotechnology Research Center, National Chung Hsing University, Taichung, Taiwan. Animal housing, sample collection, protein extraction, proteomic analysis, immunofluorescence analysis, RNA isolation, quantitative real-time polymerase chain reaction (qPCR), and statistical analysis were performed under controlled laboratory conditions at the institution.

Study design

Sexually mature female CD-1 mice (8 weeks old, 30–35 g, n = 18) were purchased from BioLASCO Taiwan, Taipei, Taiwan. Mice were housed in individually ventilated cages under specific pathogen-free conditions with controlled temperature (22 ± 2°C), relative humidity (50%–60%), and a 14:10 h light-dark cycle. Animals had ad libitum access to standard rodent chow and water and were acclimatized for at least 7 days before experimentation. Mice were randomly assigned to mating pairs. Estrous cycle staging was performed by vaginal cytology before mating to ensure synchronization. Females were housed overnight with fertile males of the same strain, and successful mating was confirmed the following morning by the presence of a vaginal plug, designated as Day 1 of pregnancy. Animals were then allocated into two experimental groups corresponding to Day 1 and Day 4 of pregnancy (n = 9 per group). Chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Sample collection

Pregnancy was confirmed by the presence of a vaginal plug (Day 1), and Day 4 samples were collected at the expected peri-implantation stage based on established mouse reproductive timelines; however, direct confirmation of blastocyst presence by uterine flushing was not performed. One biological replicate consisted of pooled endometrial epithelial cells collected from three mice on either Day 1 or Day 4 of gestation. Three independent biological replicates were included for each group (total n = 9 mice per group). Pooling was performed to ensure sufficient protein yield for 2-DE analysis and to reduce inter-individual variability inherent in biological samples. Endometrial isolation was performed as previously described [18]. Although epithelial cells were isolated using an established protocol, no additional quantitative assessment of epithelial purity was performed. Therefore, minor contamination from stromal cells cannot be completely excluded. Briefly, excised uterine horns were flushed with 0.75% ethylenediaminetetraacetic acid (EDTA; pH 7.4) in Dulbecco's phosphate-buffered saline and incubated at 37°C for 20 min under 5% CO₂. The endometrial epithelium was then carefully separated from the inner uterine wall for protein extraction. Endometrial epithelial cells were lysed in extraction buffer containing 9.5 M urea, 2% NP-40, 2% (v/v) pharmalyte (pH 3–10), and 65 mM dithiothreitol (DTT), supplemented with a protease inhibitor cocktail. Lysates were stored at −80°C until 2-DE analysis. Protease inhibitor cocktail (Roche Complete™, Roche Diagnostics, Basel, Switzerland, EDTA-free) was added fresh at 1× concentration. Protein concentration was determined using the Bradford assay (Bio-Rad Protein Assay, Bio-Rad Laboratories, Hercules, CA, USA) with bovine serum albumin as the standard.

Two-dimensional gel electrophoresis

Total protein concentration was determined using the Bradford assay according to the manufacturer's instructions before electrophoresis. Equal amounts of protein (400 µg) were loaded for each biological replicate to ensure consistency across samples. Soluble proteins were extracted from pooled endometrial epithelial tissues collected on Days 1 and 4 of pregnancy, with three independent biological replicates per group. For 2-DE, 400 µg of total protein per sample was applied to 18-cm immobilized pH gradient (IPG) strips (pH 3–10 linear; Amersham Biosciences, Uppsala, Sweden) using an IPGphor system (Amersham Biosciences, Uppsala, Sweden). Protein samples were mixed with 175 µL of IEF buffer (9.5 M urea, 2% NP-40, 2% pharmalyte 3–10, and 65 mM dithiothreitol [DTT]), followed by an equal volume of rehydration buffer (8 M urea, 2% CHAPS, and 0.5% pharmalyte 3–10) to a final volume of 350 µL. Samples were loaded onto strip holders and rehydrated at 30 V for 12 h. Isoelectric focusing (IEF) was performed at 20°C with a voltage gradient: 500 V for 1 h, 1000 V for 1 h, then 8000 V over 3 h, followed by 8000 V until 64,000 Vh total. Second-dimension gels were run at 15°C with constant power of 2.5 W/gel for 25 min, then 6 W/gel until the bromophenol blue front reached the bottom of the gel (approximately 7–8 h). Gels were stained overnight with colloidal Coomassie Brilliant Blue (Serva Electrophoresis, Heidelberg, Germany), neutralized with 0.1 M Tris-phosphoric acid (pH 6.5), destained with 25% methanol, and washed with distilled water. Gel images were acquired using a laser densitometer and processed with ImageQuant software. No exogenous internal standard was included for 2-DE; therefore, protein expression levels were normalized using the relative volume (RVol) method in Melanie 7 software, in which each spot's volume was normalized to the total volume of all detected spots on the same gel. All samples were processed under identical experimental conditions, and gel images were assessed for quality and reproducibility across biological replicates. Only gels showing consistent spot patterns and without evident artifacts were included for downstream analysis. Experimental procedures and reporting were conducted in accordance with established best practices for gel-based proteomics to ensure methodological transparency and reproducibility. This study complies with the Minimum Information About a Proteomics Experiment guidelines for gel-based proteomics.

Analysis of differential protein expression

Spot detection and matching were performed automatically using Melanie 7 software (version 7; GeneBio, Geneva, Switzerland), followed by manual verification. Although full blinding was not implemented, automated image analysis and standardized processing were applied to minimize potential bias. All samples were processed and analyzed under identical experimental conditions to ensure consistency. Although analyses were not performed in a fully blinded manner due to the nature of gel-based proteomics workflows, automated image analysis and standardized processing were applied to minimize potential bias. A total of 674 protein spots were detected across all gels. To normalize staining variability, the RVol of each spot was calculated as the ratio of the spot volume to the total volume of all detected spots. Differential expression was determined based on the ratio of RVol values between groups [19, 20]. For interpretation, a ratio (Day 1/Day 4) >1 indicates higher expression on Day 1 (downregulated on Day 4), whereas a ratio <1 indicates higher expression on Day 4 (upregulated on Day 4).

Protein identification

Protein spots showing significant differential expression between Days 1 and 4 were excised and subjected to in-gel digestion following previously described protocols with minor modifications. Excised gel spots were washed with double-distilled water, followed by 50% acetonitrile in 50 mM ammonium bicarbonate and then pure acetonitrile, and subsequently dried in a SpeedVac concentrator. Excised gel spots were destained, reduced with 10 mM dithiothreitol, alkylated with 55 mM iodoacetamide, and digested with sequencing-grade trypsin (20 ng/µL; Promega, Madison, WI, USA) overnight at 37°C. Peptides were extracted using acetonitrile/trifluoroacetic acid solution, followed by sonication, and subjected to MALDI-TOF/MS analysis. MS and MS/MS data were processed using the Mascot search engine against the National Center for Biotechnology Information non-redundant database with taxonomy restricted to Mus musculus. Carbamidomethylation (C) was set as a fixed modification, and oxidation (M) as a variable modification. Trypsin was specified as the digestion enzyme with one missed cleavage allowed. The peptide mass tolerance was set to ±100 ppm and fragment mass tolerance to ±0.5 Da. Protein identification was considered significant when Mascot scores exceeded the p < 0.05 threshold. Functional annotation of the identified proteins was performed using the Gene Ontology database (AmiGO 2). MALDI-TOF/MS analysis was performed using a Bruker Autoflex III mass spectrometer (Bruker Daltonics, Bremen, Germany) operated in reflector positive-ion mode. Spectra were acquired by accumulating 200–500 laser shots per spot. External calibration was performed using Bruker Peptide Calibration Standard II. Peak detection and processing were carried out using FlexAnalysis software with a signal-to-noise ratio threshold >3 and a minimum resolution of 500.

Immunofluorescence analysis

Immunofluorescence staining was performed on 5-μm paraffin-embedded uterine sections collected on Days 1 and 4 of pregnancy. Sections were mounted on poly-L-lysine-coated slides, dried overnight at 37°C, and incubated at 65°C for 10 min before deparaffinization in xylene and rehydration through a graded ethanol series. Antigen retrieval was carried out in 0.01 M sodium citrate buffer (pH 6.0) at 98°C for 20 min. Sections were washed in Tris-buffered saline containing 0.05% Tween-20 (TBST) and blocked with 3% bovine serum albumin in TBST for 1 h 25°C ± 25°C to reduce nonspecific binding. Sections were incubated overnight at 4°C with primary antibodies against Gstm2 (1:200; PA5-75995; Invitrogen, Carlsbad, CA, USA), vimentin (1:200; PA5-27231; Invitrogen), and PCNA (1:200; PA5-27214; Invitrogen). All primary antibodies were commercially obtained and used according to the manufacturer's instructions. Antibody specificity was evaluated using negative controls (omission of primary antibody), which showed no detectable signal, and by confirming that staining patterns were consistent with previously reported localization in uterine tissues. Following primary antibody incubation, sections were washed and incubated with fluorescein isothiocyanate (FITC)-conjugated anti-rabbit secondary antibody (1:200; ab150077; Abcam, Cambridge, UK) for 1 h at 37°C in the dark. Nuclei were counterstained with DAPI. Fluorescence images were captured using a fluorescence microscope with identical exposure settings across all groups to enable qualitative comparison. Image acquisition parameters were kept constant across samples to ensure consistency in signal interpretation.

RNA isolation and qPCR

Total RNA was extracted from endometrial epithelial cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA quality was assessed by NanoDrop spectrophotometry (Thermo Fisher Scientific, Wilmington, DE, USA; A260/280 >1.8, A260/230 >2.0) and agarose gel electrophoresis. cDNA was synthesized from 1 µg total RNA. RNA was reverse-transcribed into complementary DNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Basel, Switzerland). qPCR was performed using a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Relative gene expression levels of vimentin and Gstm2 were calculated using the comparative Ct (2^−ΔΔCt) method, with glyceraldehyde-3-phosphate dehydrogenase as the internal control. Primer specificity was verified by melt curve analysis, which showed a single peak for each target gene, and by agarose gel electrophoresis, which showed a single product of the expected size. Primer efficiencies (90%–110%) were determined using standard curve analysis. Melt curve analysis confirmed the amplification of a single specific product for each gene. No-template controls were included to verify the absence of contamination. Primer sequences and amplicon sizes are provided in Table 1.

Gene | Forward primer (5 ′– 3 ′ ) | Reverse primer (5 ′– 3 ′ ) | Product size (bp) | Accession No.
GAPDH | GTCGTGGAGTCTACTGGTGTC | GAGCCCTTCCACAATGCCAAA | 240 | NM_001357943.2
Vimentin | CGGCTGCGAGAGAAATTGC | CCACTTTCCGTTCAAGGTCAAG | 124 | NM_011701.4
Gstm2 | CCATGGTTTGCAGGGAACAAG | AGAAGAAAGCTGCACGTGGT | 300 | NM_008183.4

Statistical analysis

Data are presented as mean ± standard error of the mean. Differences between Day 1 and Day 4 groups were analyzed using a two-tailed unpaired Student's t-test (SAS version 9.1; SAS Institute Inc., Cary, NC, USA), with p < 0.05 considered statistically significant. For proteomic analysis, proteins were considered differentially expressed based on combined criteria of p < 0.05 and ≥2-fold change. GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA) was used to visualize qPCR and immunofluorescence data. Given the exploratory nature of two-dimensional gel-based proteomics, this combined threshold was applied to reduce potential false-positive findings. With 674 protein spots analyzed, approximately 5% (≈34 spots) would be expected to be identified as significant by chance alone at this threshold. Although a formal false discovery rate correction was not applied, selected candidate proteins were independently validated by immunofluorescence and quantitative real-time PCR, providing additional biological support for the observed changes. Future studies employing high-resolution quantitative proteomics with appropriate multiple-testing correction are warranted to further enhance statistical robustness. No formal power analysis was conducted, as this study was designed as an exploratory proteomic investigation. Instead, stringent selection criteria combined with independent validation experiments were applied to enhance the reliability of the findings.