Section 2 of 8
MATERIALS AND METHODS
Arnon Pudgerd, Laorrat Phuapittayalert, Kamonwan Jongsomchai, Sirilak Sanpa, Sirikarn Sanpa, Paiboon Panase, Pornpan Pumirat, Sukanya Saedan, Rapeepun Vanichviriyakit, and Charoonroj Chotwiwatthanakun · about 17 minutes
Ethical approval
All experimental procedures involving giant freshwater prawns (_M. _rosenbergii) were reviewed and approved by the Laboratory Animals Research Center, University of Phayao, and the Animal Ethics Committee of the University of Phayao, Thailand (Approval No. 63 01 04 010; approved on 4 August 2020). The study was conducted in accordance with institutional guidelines for the care and use of aquatic animals in research and relevant standards for animal welfare, biosafety, and humane experimental practice.
Healthy adult prawns were acclimatized before the experiment and maintained under controlled water quality conditions to minimize stress. Animal handling, dietary intervention, bacterial challenge with _A. _hydrophila, hemolymph collection, tissue sampling, and survival monitoring were performed only by trained personnel using standardized procedures. The number of prawns used was limited to the minimum required to achieve the study objectives, and the sample size was determined before experimentation using G*Power software. During the challenge experiment, animals were monitored regularly for abnormal behavior, morbidity, and mortality. All efforts were made to reduce pain, distress, and unnecessary handling throughout the study. Moribund prawns and dead animals were promptly removed from the tanks, and biological waste and bacterial cultures were handled and disposed of in accordance with institutional biosafety procedures.
Study period and location
The study was conducted from March to May 2021 at the laboratory and aquaculture research facilities of the University of Phayao, Phayao, Thailand. Healthy adult _M. _rosenbergii were obtained from a local commercial farm in Chiang Rai, Thailand, and transported to the laboratory for acclimatization before the feeding trial and bacterial challenge experiment.
Study design
This study evaluated the effects of partial replacement of fishmeal with fermented L. leucocephala on immune responses and resistance to _A. _hydrophila infection in adult _M. _rosenbergii. Three dietary treatments were prepared: a control diet, a diet in which 10% of fishmeal was replaced with fermented L. leucocephala, and a diet in which 20% of fishmeal was replaced with fermented L. leucocephala. After acclimatization, prawns were randomly allocated to dietary groups and fed for 2 weeks before challenge with _A. _hydrophila. Hemolymph, hematopoietic tissue, and intestinal samples were collected at predetermined time points for immunological, histological, and molecular analyses. A separate survival experiment was conducted using three independent replicate tanks per treatment group.
Macrobrachiumrosenbergii culture
Healthy _M. _rosenbergii weighing 25–30 g were obtained from a local farm in Chiang Rai, Thailand, and maintained in the laboratory under acclimatized conditions for 7 days before the start of the experiment. Adult prawns were selected because the present study primarily focused on immune status and immune-related responses following dietary supplementation and bacterial challenge. In addition, their larger body size facilitated the collection of hemolymph for immunological and molecular analyses. During acclimatization, prawns were fed a commercial diet three times daily at 07:00, 13:00, and 19:00 h.
Bacterial culture
The _A. _hydrophila culture and the protocol for determining the median lethal dose in _M. _rosenbergii were described previously [20]. The stock culture of L. plantarum TISTR1284 was stored in the laboratory at −80°C in de Man, Rogosa, and Sharpe medium (HiMedia Laboratories Pvt. Ltd., Mumbai, India) containing 20% glycerol. The thawed stock culture was cultivated in fresh medium and incubated at 37°C for 48 h. The culture was harvested, and the optical density at 600 nm was adjusted to 0.1 using 0.85% sterile NaCl solution to obtain an inoculum concentration of 1.5 × 10⁸ CFU/mL.
Preparation of fermented L. leucocephala
L. leucocephala leaf tips were collected, washed, and air-dried. Fermentation was performed using L. plantarum TISTR1284 at an inoculum level of 1 × 10⁶ CFU/g plant material following a modified method described previously [21]. The plant material was packed in airtight containers and incubated under anaerobic conditions at room temperature (25°C–30°C) for 30 days. After fermentation, samples were oven-dried and ground into a fine powder for diet formulation. Amino acid composition of fermented and non-fermented samples was analyzed by Central Laboratory (Thailand) Co., Ltd., Bangkok, Thailand, using high-performance liquid chromatography, and the results were expressed as mg/100 g dry weight (Table 1).
Amino acid | Non-fermented L. leucocephala (mg/100 g) | Fermented L. leucocephala (mg/100 g)
Toxic non-protein amino acid | |
Mimosine | 92.46 | 53.46
Essential amino acids | |
Phenylalanine | 2309 | 2973
Histidine | 1658 | 1680
Leucine | 2291 | 2829
Lysine | 5695 | 7092
Methionine | <20 | <20
Valine | 1063 | 1236
Threonine | 248 | 262
Non-essential amino acids | |
Aspartic acid | 1026 | 1216
Glutamic acid | 1413 | 1340
Alanine | 678 | 814
Cystine | 246 | 320
Glycine | 479 | 510
Hydroxyproline | <20 | <20
Hydroxylysine | <20 | <20
Proline | 546 | 641
Serine | 383 | 903
Isoleucine | 1183 | 1374
Tyrosine | 2116 | 2152
Tryptophan | 248 | 245
Antioxidant and phytochemical activities were analyzed as shown in Table 2. Fermentation increased most essential and non-essential amino acids while reducing mimosine content, indicating improved nutritional quality of L. leucocephala leaves (Table 1).
Experimental diets
Three diets were prepared for this study. The control diet was formulated using fishmeal as the primary protein source, whereas the two experimental diets incorporated fermented L. leucocephala powder to replace 10% or 20% of fishmeal, designated as the 10% L. leucocephala and 20% L. leucocephala diets, respectively. The dry ingredients were homogenized and subsequently combined with 30% water to form a uniform mash. This mixture was processed into pellets using an extruder (EXT15HP3V03; Siam Farm Services Co., Ltd., Bangkok, Thailand) fitted with a 2-mm die. The pellets were dried at 4°C under forced-air circulation until the moisture content was reduced to approximately 10%. Once dried, all diets were sealed and stored at −20°C until further use.
The ingredient composition of the control and experimental diets is summarized in Table 3. The experimental diets were formulated to evaluate the practical replacement of fishmeal with fermented L. leucocephala powder and were not designed to be strictly isonitrogenous or isolipidic.
Sample | DPPH IC₅₀ ( μg /mL) | ABTS⁺ IC₅₀ ( μg /mL) | FRAP (mg FeSO ₄/g extract) | TPC (mg GAE/g extract) | TFC (mg CE/g extract)
Non-fermented L. leucocephala | 458.49 ± 3.26ᵃ | 152.60 ± 2.88ᵃ | 419.61 ± 24.39ᵃ | 171.50 ± 5.44ᵃ | 17.429 ± 1.12ᵃ
Fermented L. leucocephala | 984.12 ± 12.23ᵇ | 142.19 ± 1.74ᵃ | 259.84 ± 16.09ᵇ | 163.56 ± 7.33ᵃ | 12.336 ± 0.77ᵇ
Item | Basal diet | 10% fermented L. leucocephala | 20% fermented L. leucocephala
Ingredients (%) | | |
Fish meal | 35 | 25 | 15
Fermented L. leucocephala leaves with L. plantarum TISTR1284 | 0 | 10 | 20
Shrimp shell meal | 14 | 14 | 14
Soybean meal | 25 | 25 | 25
Wheat meal | 5 | 5 | 5
Squid oil | 4 | 4 | 4
Corn grain | 5 | 5 | 5
Rice bran | 10 | 10 | 10
Vitamin and mineral premix | 2 | 2 | 2
Proximate composition (%) | | |
Crude protein* | 44.63 ± 0.18ᵃ | 41.14 ± 0.44ᵇ | 36.75 ± 0.28ᶜ
Crude lipid* | 4.79 ± 0.32ᵇ | 4.85 ± 0.28ᵇ | 5.95 ± 0.07ᵃ
Ash* | 16.26 ± 0.57ᵃ | 13.75 ± 0.39ᵇ | 12.37 ± 0.18ᶜ
Carbohydrate* | 12.81 ± 0.27ᵃ | 17.43 ± 0.98ᵇ | 23.14 ± 0.75ᶜ
Fiber* | 12.46 ± 0.46ᵇ | 14.14 ± 0.14ᵃ | 12.37 ± 0.18ᵇ
Moisture* | 9.05 ± 0.15ᵃ | 8.69 ± 0.32ᵃ | 8.01 ± 0.11ᵇ
Following diet preparation, pellet samples were analyzed for amino acid and fatty acid profiles by Central Laboratory (Thailand) Co., Ltd., and the results are presented in Tables 4 and 5.
Proximate composition analysis
Proximate composition analysis of the experimental diets, including crude protein, crude lipid, ash, moisture, crude fiber, and carbohydrate contents, was conducted according to standard procedures described by the Association of Official Analytical Chemists [22]. Crude protein was determined using the Kjeldahl method, crude lipid by Soxhlet extraction, moisture by oven drying, and ash by combustion in a muffle furnace. Carbohydrate content was calculated by difference using the following formula:
% Carbohydrate = 100 − (% Moisture + % Fat + % Ash + % Crude fiber + % Protein)
The results of proximate composition analysis are shown in Table 3.
Total phenolic content (TPC)
TPC of fermented and non-fermented L. leucocephala leaf powder and experimental diets was analyzed using the Folin–Ciocalteu colorimetric method with modifications [23]. Briefly, 100 µL of each extract was mixed with 125 µL of Folin–Ciocalteu reagent, followed by the addition of 300 µL of 20% sodium carbonate solution. The reaction mixture was adjusted to a final volume of 1 mL with double-distilled water and incubated at 25–30°C in the dark for 2 h. Absorbance was measured at 760 nm using a UV–Vis spectrophotometer. Gallic acid was used as the calibration standard, and the results were expressed as mg GAE/g extract.
Amino acid | 0% fermented L. leucocephala (mg/100 g) | 10% fermented L. leucocephala (mg/100 g) | 20% fermented L. leucocephala (mg/100 g)
Essential amino acids | | |
Phenylalanine | 1773.36 | 1764.72 | 1590.50
Histidine | 976.49 | 963.31 | 831.25
Leucine | 3065.22 | 3059.89 | 2694.95
Lysine | 2711.91 | 2602.23 | 2132.84
Methionine | 758.82 | 697.70 | 538.76
Valine | 1911.37 | 1915.39 | 1730.93
Threonine | 1756.02 | 1721.07 | 1489.27
Non-essential amino acids | | |
Aspartic acid | 4654.87 | 4591.17 | 4052.13
Glutamic acid | 6896.02 | 6785.67 | 5705.99
Alanine | 2413.33 | 2358.42 | 2013.82
Cystine | 421.18 | 401.04 | 344.95
Glycine | 2471.71 | 2362.73 | 2003.59
Hydroxyproline | <500.00 | <500.00 | <500.00
Hydroxylysine | ND | ND | ND
Proline | 1885.07 | 1891.33 | 1644.76
Serine | 1916.24 | 1890.40 | 1650.81
Isoleucine | 1655.99 | 1653.26 | 1467.55
Tyrosine | 1496.31 | 1468.86 | 1263.05
Tryptophan | 387.04 | 379.41 | 322.55
Total flavonoid content (TFC)
TFC of fermented and non-fermented L. leucocephala leaf powder and experimental diets was determined using the aluminum chloride colorimetric method [23]. Briefly, 250 µL of extract was mixed with 75 µL of 5% sodium nitrite solution and incubated for 6 min. Then, 150 µL of 10% aluminum chloride solution was added, and the mixture was incubated for 5 min. Subsequently, 500 µL of 1 M sodium hydroxide was added, and the volume was adjusted to 2.5 mL with distilled water. Absorbance was measured at 510 nm using a UV–Vis spectrophotometer. Catechin was used as the reference standard, and the results were expressed as mg CE/g extract.
Evaluation of antioxidant activities
DPPH radical scavenging activity: Fermented and non-fermented L. leucocephala leaf powder and experimental diets were evaluated using the DPPH radical scavenging assay [23]. DPPH solution was prepared in ethanol and protected from light before use. The extracts were diluted in ethanol at different concentrations (0–20 mg/mL). Twenty microliters of sample solution was combined with 180 µL of DPPH solution in a 96-well microplate, then incubated in the dark at 37°C for 30 min. Absorbance was read at 540 nm using a microplate reader. Ascorbic acid and Trolox were used as positive controls, whereas DPPH solution without sample was used as the negative control. Radical scavenging activity was expressed as percentage inhibition, and IC50 values were obtained by nonlinear regression analysis using GraphPad Prism version 10.5.0.774 (GraphPad Software, Boston, MA, USA).
ABTS radical scavenging activity: ABTS radical scavenging activity of fermented and non-fermented L. leucocephala leaf powder and experimental diets was determined using a previously reported method with modifications [23]. Briefly, 20 µL of extract at various concentrations (0–20 mg/mL) was mixed with 2.0 mL of diluted ABTS working solution. The ABTS radical cation was generated by mixing 7.5 mM ABTS stock solution with 2.5 mM potassium persulfate in the dark at 25°C–30°C for 16 h. The reaction mixtures were incubated for 5 min at 25°C, and absorbance was measured at 734 nm using a UV–Vis spectrophotometer (Optizen POP, Mecasys Co., Ltd., Daejeon, Korea). Percentage inhibition and IC50 values were calculated using dose-response curves generated with GraphPad Prism software.
Fatty acid | 0% fermented L. leucocephala (g/100 g) | 10% fermented L. leucocephala (g/100 g) | 20% fermented L. leucocephala (g/100 g)
Lauric acid | 0.02 | 0.02 | 0.02
Myristic acid | 0.13 | 0.13 | 0.12
Pentadecanoic acid | 0.04 | 0.04 | 0.04
Palmitic acid | 1.50 | 1.80 | 2.02
Heptadecanoic acid | 0.05 | 0.05 | 0.04
Stearic acid | 0.44 | 0.53 | 0.57
Saturated fatty acids | 2.21 | 2.60 | 2.85
Palmitoleic acid | 0.16 | 0.14 | 0.11
Cis-9-oleic acid | 1.79 | 1.65 | 1.49
Cis-11-eicosenoic acid | 0.09 | 0.15 | 0.17
Erucic acid | 0.04 | 0.03 | 0.03
Nervonic acid | 0.02 | 0.02 | 0.03
Monounsaturated fatty acids | 2.11 | 2.02 | 1.85
Cis-9,12-linoleic acid | 0.82 | 0.84 | 0.68
Gamma-linolenic acid | 0.03 | 0.04 | 0.05
Alpha-linolenic acid | 0.04 | 0.04 | 0.04
Cis-11,14-eicosadienoic acid | 0.01 | 0.01 | ND
Cis-8,11,14-eicosatrienoic acid | 0.03 | 0.03 | 0.03
Cis-11,14,17-eicosatrienoic acid | 0.05 | 0.04 | 0.03
Cis-13,16-docosadienoic acid | 0.01 | ND | ND
Cis-5,8,11,14,17-eicosapentaenoic acid | 0.05 | 0.05 | 0.02
4,7,10,13,16,19-docosahexaenoic acid | 0.08 | 0.09 | 0.03
Polyunsaturated fatty acids | 1.12 | 1.15 | 0.88
Unsaturated fatty acids | 3.23 | 3.17 | 2.73
Trans fat | 0.01 | 0.02 | 0.02
FRAP assay
The reducing ability of fermented and non-fermented L. leucocephala leaf powder and experimental diets was determined using the FRAP assay [24]. The assay is based on the reduction of ferric ions to ferrous ions, forming a blue Fe²⁺/TPTZ complex. The extract was mixed with freshly prepared FRAP reagent and incubated at 25°C–30°C for 30 min. Absorbance was recorded at 593 nm using a UV–Vis spectrophotometer. Antioxidant activity was expressed as mg FeSO₄/g extract.
Experimental challenge and sampling
To evaluate whether replacing fishmeal protein with fermented L. leucocephala leaves affects the immune system of prawns, adult prawns were selected because they possess a fully developed immune system, allowing consistent and reliable evaluation of diet-induced immune responses. For the experimental challenge and immune assessment, prawns were acclimatized for 1 week, during which they were fed the control diet three times daily at 07:00, 13:00, and 19:00 h. They were then randomly divided into three groups (n = 70 per group) and maintained in plastic tanks (44 × 62 × 34 cm) containing 45 L of aerated water, with 15 prawns per tank.
Sample size determination was performed using G*Power software version 3.1.9.7 prior to experimentation to ensure adequate statistical power to detect differences among treatment groups. Group 1 received the basic diet and served as the control group. Group 2 received the basic diet with 10% fishmeal replaced by fermented L. leucocephala. Group 3 received the basic diet with 20% fishmeal replaced by fermented L. leucocephala. Prawns were fed three times daily at 07:00, 13:00, and 19:00 h for 2 weeks.
After the 2-week feeding period, prawns were injected with _A. _hydrophila at a dose corresponding to the previously reported median lethal dose for _M. _rosenbergii (8.91 × 10⁵ CFU/mL) [20] and maintained under the same feeding regimen and environmental conditions for 1 week. At each sampling time point (6, 12, 24, 48, 72, 96, and 120 h post-infection), five prawns were randomly selected from each treatment group for collection of hemolymph, hematopoietic tissue, and intestinal samples for immunological analyses. This experiment was conducted using a single replicate per treatment group. For the survival experiment, prawns were divided into three groups as described above, with n = 15 per group. This experiment was conducted using three independent replicate tanks per treatment group to observe and record mortality.
Water quality parameters
Water quality parameters were monitored throughout the experimental period. Water temperature was maintained at 27°C–29°C, DO above 5 mg/L, and pH at 7.5–8.0. Total ammonia and nitrite concentrations were maintained below 0.1 mg/L and 0.5 mg/L, respectively, which are within acceptable ranges for _M. _rosenbergii culture [25]. To maintain water quality, approximately 30%–50% of the water was replaced every 3 days, and the filtration system was operated continuously throughout the experiment.
Total hemocyte count
Hemolymph (500 µL) was withdrawn from the heart of _M. _rosenbergii into a 1-mL syringe containing cold Alsever’s solution and transferred to a 1.5-mL microcentrifuge tube. A drop of mixed hemolymph was placed on a hemocytometer, and total hemocyte count was determined under a light microscope (Olympus CX22; Olympus Corporation, Tokyo, Japan). Hemocyte counting was performed by an investigator blinded to the treatment groups.
PO activity
PO activity in hemolymph was measured according to a previously described protocol with modifications [26]. Briefly, 100 µL of hemolymph was withdrawn from the heart into a 1-mL syringe containing 900 µL of cold Tris-buffered saline-I (50 mM Tris, 210 mM NaCl, 5 mM KCl, and 2.5 mM MgCl₂, pH 7.5). The hemolymph was centrifuged at 5000 × g for 15 min at 4°C to separate hemocytes, and the resulting hemolymph supernatant was collected for PO activity analysis. Ten microliters of hemolymph were incubated with 190 µL of 5 mM L-DOPA (D9628; Sigma-Aldrich, St. Louis, MO, USA) dissolved in 50 mM Tris-HCl, pH 7.5, for 20 min at 25°C to develop dopachrome. The dopachrome reaction was measured at 490 nm using a VersaMax™ Microplate Reader (Molecular Devices, San Jose, CA, USA).
Histology
Hematopoietic tissue was collected, fixed in Davison’s fixative for 24 h, and then washed with 70% ethanol. The tissue was processed using an automatic sample preparation system (Tissue-Tek® VIP™ 5 Jr.; Sakura Finetek Japan Co., Ltd., Tokyo, Japan) and embedded in paraffin. Paraffin blocks were sectioned at 5 µm, and the sections were placed on glass slides. Tissue sections were stained with Mayer’s hematoxylin (Cat. No. 05-06002/L; Bio-Optica Milano SpA, Milan, Italy) and eosin Y plus alcoholic solution (Cat. No. 05-11007/L; Bio-Optica Milano SpA). Hematopoietic tissue sections were examined under a light microscope (Nikon Upright Microscope Eclipse Ni-U; Nikon Corporation, Tokyo, Japan) at 40× magnification. Prophase, metaphase, anaphase, and telophase in hematopoietic cell nuclei were counted and averaged. Mitotic cell quantification was performed by an investigator blinded to the treatment groups.
Quantitative real-time polymerase chain reaction (PCR)
Total RNA was isolated from various tissues of _M. _rosenbergii using Tri Reagent® (Cat. No. TR118; Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s protocol. RNA quality and quantity were assessed by measuring absorbance at 260 and 280 nm using NanoDrop One (Thermo Fisher Scientific, Waltham, MA, USA). One microgram of RNA was subjected to cDNA synthesis using ReverTra Ace™ quantitative (q)PCR RT Master Mix with gDNA Remover (TOYOBO Co., Ltd., Osaka, Japan) according to the manufacturer’s protocol. The cDNA was stored at −20°C until further analysis.
The cDNA samples were analyzed for relative expression levels of the genes anti-lipopolysaccharide factor (ALF), Crustacean hematopoietic factor (CHF), proPO, Relish, TRAF6, Dorsal, IMD, HSP70, and Cu/Zn-SOD in hemocytes and hematopoietic tissue using QIAquant 96 5plex (Qiagen, Hilden, Germany). Amplification was performed in a 96-well plate with a 20-µL fluorescent qPCR reaction mixture. The reaction mixture contained 1 µL of cDNA, 10 µL of SensiFAST™ SYBR® No-ROX kit (BIO-98050; Meridian Bioscience, Cincinnati, OH, USA), 0.4 µL each of forward and reverse primers (10 µM/µL), and 8.2 µL of sterile dH₂O. All qRT-PCR primers are listed in Table 6[27–32].
The thermal qRT-PCR cycle profile followed the manufacturer’s protocol: one cycle of enzyme activation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 5 s and annealing/extension at 60°C for 20 s. Sterile dH₂O served as the negative control. EF-1α was selected as the reference gene for normalization. After completion of the qRT-PCR program, data were analyzed using QIAquant96 software. The baseline was set automatically by the software to maintain consistency. The comparative CT (2−ΔΔCT) method was used to analyze gene expression levels [33].
Gene | Primer sequence (5′–3′) | Accession No. | Amplicon size (bp) | Reference
ALF | F: GTCTTGGGTTGTTTTGGTAA | * | 103 | [27]
| R: CATCGTTACTTCCCACTTGT | | |
CHF | F: GAGGGTCTGTCTTGCTACTG | MH595490.1 | 220 | [27]
| R: GGTACTTCTCCTCGTCTCCT | | |
C-lectin | F: ACTCTGTTGGACAACTCCAC | * | 248 | [28]
| R: ACCCGGAGAGAAAGTAAGAC | | |
Relish | F: GATGAGCCTTCAGTGCCAGA | KR827675.1 | 240 | [29]
| R: CCAGGTGACGCCATGTATCA | | |
IMD | F: CGACCACATTCTCCTCCTCCC | MT123546.1 | 220 | [29]
| R: TTCAGTGCATCCACGTCCCTC | | |
Dorsal | F: TCAGTAGCGACACCATGCAG | KX219631.1 | 360 | [29]
| R: CGAGCCTTCGAGGAACACTT | | |
TRAF6 | F: TCTGGATTGTGGTCCCACTG | MH507502.1 | 117 | [30]
| R: ATGGGTCGCTGAAATGCTTG | | |
proPO | F: ACTCTTCCATCACTGCACCG | DQ182596.1 | 360 | [31]
| R: CCTGCCTCGGATGACTTGTT | | |
HSP70 | F: GTCCTGATGAAGATGAAGGA | MH846234.1 | 360 | [31]
| R: CCTTGCCACTTGTTACTTTC | | |
Cu/Zn-SOD | F: TCGCCTAACGAGGAGGTTC | DQ121374.1 | 81 | [32]
| R: CGGCTTCATCAGGATTTTGAG | | |
EF-1α | F: ATGTCATGGTGGAAGAAGAG | KF228019.1 | 360 | [27]
| R: AAAGTTGACCACCATACCAG | | |
Statistical analysis
Data are presented as mean ± standard deviation. Statistical analyses were performed using GraphPad Prism software version 10.5.0.774 (GraphPad Software, Boston, MA, USA). Before statistical analysis, data normality was assessed using the Shapiro–Wilk test, and homogeneity of variance was evaluated using the Brown–Forsythe test. Data that satisfied parametric assumptions were analyzed using one-way analysis of variance, followed by Tukey’s multiple comparisons test. When assumptions of normality or homogeneity of variance were not met, non-parametric analysis was performed using the Kruskal–Wallis test followed by Dunn’s multiple comparison test. Survival data were analyzed using the Kaplan–Meier method. Differences were considered statistically significant at p < 0.05.