Section 2 of 8
MATERIALS AND METHODS
Cheng‐Cheng Wang, Qi‐Lin Zhang, Zhen‐Le Zang, Hua‐Chun Yin, Yu Pan, Yi‐Fei Yu, Yi‐Ming Li, Zhao‐Yun Zhang, Song Li, and Hui Yang · about 7 minutes
Animals
In this experiment, 2‐month‐old C57BL/6 mice, Sprague–Dawley (SD) rats, and 3‐month‐old Bama pigs were housed under standard and appropriate conditions, maintained on a 12‐h light/12‐h dark cycle, with ad libitum access to food and water. Animals were anesthetized with an intraperitoneal injection of 1% sodium pentobarbital (50 mg/kg) and euthanized. All experimental procedures were conducted in accordance with the principles of laboratory animal care and were approved by the Ethics Committee (AMUWEC20245310).
Pituitary gland dissociation
Porcine pituitary glands were dissected immediately after euthanasia, and the pituitary glands were promptly dissected and placed in sterile culture dishes. Tissues were rinsed 1–2 times with ice‐cold DPBS (Thermo Fisher, 14,190,144), minced into 1–2 mm3 fragments, and digested enzymatically at 37°C in a shaking water bath. Cell suspensions were filtered using a 40 μm nylon cell strainer, and red blood cells were lysed using Red Blood Cell Lysis Solution (Thermo Fisher, 00–4333–57). Cells were washed, resuspended in DPBS containing 2% FBS, and kept on ice. Cell concentration and viability were assessed using an automated cell counter (Countstar) with Acridine Orange/Propidium Iodide (AO/PI) staining.
10× library preparation and sequencing
A single‐cell suspension was adjusted to a concentration of 700–1200 cells/μL. Single‐cell libraries were then generated using the 10× Genomics Chromium™ Controller system. Beads with unique molecular identifier (UMI) and cell barcodes were loaded close to saturation, so that each cell was paired with a bead in a Gel Beads‐in‐emulsion (GEM). After exposure to cell lysis buffer, polyadenylated RNA molecules hybridized to the beads. Beads were retrieved into a single tube for reverse transcription. On cDNA synthesis, each cDNA molecule was tagged on the 3′ end (that is, the 5′ end of a messenger RNA transcript) with UMI and cell label indicating its cell of origin. Briefly, 10× beads were then subjected to second‐strand cDNA synthesis, adaptor ligation, and universal amplification. Sequencing libraries were prepared using randomly interrupted whole‐transcriptome amplification products to enrich the 3′ end of the transcripts linked with the cell barcode and UMI. All the remaining procedures including the library construction were performed according to the standard manufacturer's protocol (Chromium Single Cell 3′ v3.1). Sequencing libraries were quantified using a High Sensitivity DNA Chip (Agilent) on a Bioanalyzer 2100 and the Qubit High Sensitivity DNA Assay (Thermo Fisher Scientific). The libraries were sequenced on Illumina Xplus/DNBSEQ‐T7 using 2 × 150 chemistry.
Bioinformatic analyses of scRNA‐seq data
In addition to the scRNA‐seq data generated from porcine pituitaries in this study, we obtained publicly available scRNA‐seq datasets for the pituitary glands of other species. These included data from C57BL/6 mice 16 (GSM4594334, GSM4594335, GSM4594336, GSM4594338, GSM4594339) and SD rats 17 (GSE132224) from the NCBI GEO (Gene Expression Omnibus) database, as well as human pituitary data 18 , 19 (HRA002436, HRA003483) from the GSA (Genome Sequence Archive).
The UMI count matrices were obtained, imported into R, and analyzed using the Seurat package (10.1016/j.cell.2021.04.048). Low‐quality cells were removed based on the following criteria. (i) Cells with relatively high mitochondrial percentage (mitochondrial reads >10%) were removed. (ii) The thresholds for acceptable numbers of detected genes and UMIs per cell were determined by outliers in the joint distribution of unique UMIs and detected genes across cells. For the mice scRNA‐seq data, cells were filtered by retaining those with RNA counts between 200 and 40,000, fewer than 6000 detected genes. The rat dataset was subset to include cells with 200–6000 detected genes and total RNA counts below 40,000. For human samples, the merged seven datasets were subset using: nCount_RNA < 75,000, 500 < nFeature_RNA < 8000. For pig samples, cells were retained if they expressed between 100 and 7500 genes.
The datasets were log‐normalized, and highly variable genes were calculated with the FindVariableFeatures function. Cell cycle effects were regressed out using the ScaleData function. PCA was calculated using the RunPCA function, after which the RunHarmony function was used. The Harmony reduction was then used in FindNeighbors (dimensions of mice and rat dataset = 1:20 and dimensions of human and pig dataset = 1:30), FindClusters (resolution of mice and rat dataset = 0.4, resolution of human data = 0.3 and resolution of pig data = 0.5). Cell markers were used to annotate the clusters from the literature for pituitary cells. 20 , 21 , 22 , 23
Real‐time quantitative PCR
Total RNA was extracted from tissue samples using the Trizol method. Subsequently, Takara's PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time) (RR047A) was used for reverse transcription, and the resulting cDNA was stored at −20°C for future use. The qPCR reaction was performed using the SYBR Green Premix Pro Taq HS qPCR Kit (AG11701) from Accurate Biotechnology on the Agilent AriaMX Real Time PCR System. Reaction procedure: Pre‐denaturation at 95°C for 30 s; then 40 cycles of 95°C denaturation for 5 s and 60°C annealing extension for 30 s; perform melting curve analysis after the cycle ends to verify the specificity of the amplified product. Using GAPDH as an internal reference, the relative expression level of SCGN was calculated using the 2(−∆∆Cq) method. All experiments were independently repeated at least three times. SCGN primers used in the experiment: SCGN‐F: TCTTTCGCCTGGAAACTCCC and SCGN‐R: AAGAGCCAGAATCCTTGCCA.
Immunofluorescence
Immunofluorescence staining was performed using an immunofluorescence staining kit (AFIHC023) from AiFang Biological. Frozen sections (20 μm) of mouse and pig pituitary glands, as well as rat pancreas, hypothalamus, and pituitary gland were prepared. Frozen sections were thawed to room temperature, rinsed with PBS, and permeabilized with 0.3% Triton X‐100. Antigen retrieval was performed using Tris‐EDTA buffer. After blocking endogenous peroxidase and non‐specific binding sites with peroxidase inhibitors and 5% BSA, sections were incubated overnight at 4°C with the mouse monoclonal SCGN (F‐9) antibody (Santa Cruz, sc‐374355, RRID: AB_10989370). As negative controls, adjacent sections were processed in parallel by omitting the primary antibody (replaced with PBS containing 5% BSA). Polymer‐HRP conjugated goat anti‐mouse/rabbit secondary antibody was applied and incubated at room temperature for 1 h. Signal was detected using tyramide signal amplification (TSA) with TYR‐570 dye. The sections then underwent a second round of antigen retrieval, peroxidase blocking, and incubation with 5% BSA. They were subsequently incubated overnight at 4°C with one of the following primary antibodies against pituitary hormones: mouse monoclonal LH antibody (Santa Cruz, sc‐374017, RRID: AB_10917560) and rabbit monoclonal LH antibody (abcam, ab150416, RRID: AB_2928120), rabbit monoclonal FSH antibody (abcam, ab281562, RRID: AB_2928119), rabbit monoclonal ACTH antibody (abcam, ab74976, RRID: AB_1280736), rabbit polyclonal GH antibody (Proteintech, 55243‐1‐AP, RRID: AB_11182710), rabbit monoclonal PRL antibody (abcam, ab183967, RRID: AB_2814839), or rabbit monoclonal TSH antibody (absin, abs145553, RRID: AB_3720121). A second round of staining was performed using Polymer HRP conjugated goat anti‐mouse/rabbit secondary antibody and TYR‐520 dye. Nuclei were counterstained with DAPI (Biosharp, BL105A); sections were mounted using UltraCruz® Aqueous Mounting Medium with DAPI (Santa Cruz, sc‐24941). Images were captured using an Olympus BX63 fluorescence microscope to quantify the colocalization rate of SCGN with hormonal signals.
Immunohistochemistry
Three human adult anterior pituitary gland tissues were obtained from cadaveric organ donors without evidence of any endocrine disease as in our previous study. 23 Following deparaffinization and rehydration, heat‐induced epitope retrieval (HIER) was performed by submerging the slides in antigen unmasking solution (Solarbio). After blocking endogenous peroxidase and nonspecific binding sites (0.3% H2O2 and 5% normal goat serum, sequentially), primary antibodies (anti‐SCGN, Santa Cruz, sc‐374355) were applied at 4°C overnight. Slides were incubated with Dako REAL EnVision HRP rabbit/mouse (belong to K5007, DAKO, Glostrup, Denmark) at RT for 20 min, followed by treatment with Dako REAL DAB + CHROMOGEN and Dako REAL substrate buffer (belong to K5007, DAKO, Glostrup, Denmark) to visualize staining signals under light microscopy, and finally counterstained using hematoxylin solution. Stained slides were scanned using Ocus (Grundium, Tampere, Finland).
Statistical analyses
For each experimental animal, five biological replicates were used. For each pituitary sample, three tissue sections were analyzed and 3–5 fields of view per section were selected based on tissue size. The co‐localization ratio (number of SCGN‐positive cells colocalizing with a given hormone / total number of SCGN‐positive cells) was calculated for each field individually. The ratios from all fields of the three sections were then averaged to obtain a single value per animal, and group data are presented as mean ± SEM (n = 5).
All colocalization percentages were arcsine square‐root transformed using the formula Y = arcsin(sqrt(Y/100)) in GraphPad Prism 9.0.0 (Transform function) before statistical analysis. One‐way ANOVA with Tukey's post‐hoc test was performed on arcsine square‐root transformed data. For datasets that remained heteroscedastic after transformation (male pig), Welch's ANOVA was additionally performed as a sensitivity analysis; the significance outcomes were unchanged. For clarity of interpretation, untransformed percentages are presented in all figures. The F statistic, degrees of freedom, and p values are reported in the figure legends. For rats (no SCGN expression detected) and humans (no quantitative IHC comparison across cell types), ANOVA was not applicable. Statistical significance was defined as p < .05.