Work overview

Section 02 of 07

2. Materials and Methods

A Study on the Clinical Phenotypes and Genetic Analysis of ENG Variants in Four Hereditary Hemorrhagic Telangiectasia Type 1 Families

Yujing Gong, Tingmin Zhou, Xinru Fu, Yiyi Jiang, Danping Wang, Chuangjie Gu, Ruiting Wu, Dan Wang, and Chang Yu · 2026

Contents

Section 02 of 07

  1. 011. Introduction
  2. 022. Materials and Methods
  3. 033. Results
  4. 044. Discussion
  5. 05Author Contributions
  6. 06Funding
  7. 07Conflicts of Interest
Text size
Work overview

Section 2 of 7

2. Materials and Methods

Yujing Gong, Tingmin Zhou, Xinru Fu, Yiyi Jiang, Danping Wang, Chuangjie Gu, Ruiting Wu, Dan Wang, and Chang Yu · about 5 minutes

2.1. Participants

The probands and families were enrolled at the First Affiliated Hospital of Wenzhou Medical University. Relevant clinical records were collected, including physical examination, blood routine test, ultrasound examination, chest CT scan, and pulmonary angiography. Written consent was obtained from the patients′ parents prior to the commencement of the study, and approval was obtained from the Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University.

2.2. Trio WES and Sanger Sequencing

The genomic DNA extracted from 1 to 2 mL of blood samples obtained from the probands and their family members served as the material for the assay. The process began with extracting 1 _μ_g of genomic DNA from 200 _μ_L of peripheral blood using a Qiagen DNA Blood Midi/Mini kit (Qiagen GmbH, Hilden, Germany). Fragmentation enzymes then broke down 50 ng of DNA into approximately 200‐bp fragments, which were subsequently end repaired and had a single A base added to the 3 ′ end. Barcoded sequencing adaptors were then ligated to the DNA fragments, with those around 320 bp being collected using XP beads. Following PCR amplification, the DNA fragments underwent hybridization and capture using Berry′s NanoWES Human Exome V1.0 kit (Berry Genomics, Beijing, China). The hybrid products were eluted, collected, and subjected to further PCR amplification and purification. Subsequently, the libraries were quantified using qPCR, and their size distribution was determined using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, California, United States). Finally, the genomic DNA of the family was sequenced using the Novaseq6000 platform (Illumina, San Diego, United States) in 150‐bp pair‐end mode, with raw image files processed using CASAVA v1.82 for base calling and data generation. The sequencing reads were aligned to the human reference genome (hg38/GRCh38) using the Burrows‐Wheeler Aligner tool, and PCR duplicates were removed with Picard v1.57 (http://picard.sourceforge.net/). Variant calling was performed using the Verita Trekker Variants Detection System by Berry Genomics and the third‐party software GATK (https://software.broadinstitute.org/gatk/). Annotation and interpretation of variants were carried out using ANNOVAR (https://annovar.openbioinformatics.org/en/latest/) and the Enliven Variants Annotation Interpretation System authorized by Berry Genomics. Annotation databases primarily included human population databases (gnomAD and the 1000 Genome Project), in silico prediction algorithms (SIFT and FATHMM), and disease/phenotype databases (OMIM and ClinVar). This is used to determine which category the variant is judged to be in, and further reference is provided for subsequent research. The suspected mutations were subsequently verified using Sanger sequencing in the studied families (Table 1). Sanger sequencing was performed using an ABI 3730xl DNA Analyzer (Applied Biosystems, Carlsbad, California, United States).

Family | Primer sequence
Family 1 | F: CTATCTTTGGCTGTGGGTGAGGG
R: TGGTCTCTCGGGGTGGGGA
Family 2 | F: TCAGGCAACTCCACAGGGCCAT
R: CAGTGCCCCAGACACAGCAGTCCC
Family 3 | F: tgtaaaacgacggccagtGGAAGCTCCCACTTGAAGC
R: caggaaacagctatgaccGACTCAGGGGTGGGAACTC
Family 4 | F: ACTGTGTGTGTCTCTCCTCTGTGT
R: CCCTGGTGAATAATGTCAAGATG

2.3. In Silico Assay

To analyze the possible impact of the mutation, the Rare Disease Data Center (RDDC) database (https://rddc.tsinghua-gd.org/) was utilized. SpliceAI (https://spliceailookup.broadinstitute.org/#) was used for the mutation evaluation. The prediction procedure adhered to standard methodologies.

2.4. Minigene Constructs and Mutagenesis

To examine the target gene regions covering ENG exons 10–12 and introns 10–11, which were amplified from the gDNA of the proband from Family 2, an in vitro minigene assay was performed. The wild‐type (WT) ENG gene fragment was acquired through nested polymerase chain reaction (PCR), employing genomic DNA as a template and using the primers 34187‐F/36503‐R and 34424‐F/36503‐R (Table 2). Three pairs of primers (pcDNA3.1‐ENG‐BamHI‐F/ENG‐mut‐R, ENG‐mut‐F/pcDNA3.1‐ENG‐XhoI‐R, and pcDNA3.1‐ENG‐BamHI‐F/pcDNA3.1‐ENG‐XhoI‐R) were devised to amplify the heterozygous c.1428 + 2 T > C mutation site from the nested PCR product through seamless cloning (Vazyme Biotech Co. Ltd., Nanjing, China). Subsequently, the amplified DNA products were recombined and inserted into two restriction sites (BamHI/XhoI) of the pcDNA3.1 vector (Hitrobio Biotechnology Co. Ltd., Beijing, China). In addition, the recombinant plasmids pcDNA3.1‐ENG‐t (WT) and pcDNA3.1‐ENG‐mut (c.1428 + 2 T > C) were confirmed via Sanger sequencing.

Primer name | Primer sequence (5 ′–3 ′)
34187‐F | atgaagagggagcagggcag
34424‐F | ATGCAGGTGTCAGCAAGTAT
36503‐R | gacgggtaagtgaaaggatg
36754‐R | aatcctggaggcctgtctgt
pcDNA3.1‐ENG‐BamHI‐F | GCTCGGATCCATGGCGGTGGTCAATATCCTGTC
ENG‐mut‐F | AGAGCTTTGTGCAGgCacctggcatgcctgt
ENG‐mut‐R | acaggcatgccaggtGcCTGCACAAAGCTCT
pcDNA3.1‐ENG‐XhoI‐R | TAGACTCGAGCTGGTCTTGAGACCCGGTCT
pcMINI‐C‐ENG‐BamHI‐F | GCTCGGATCCggcagatcacgaggtgaaga
pcMINI‐C‐ENG‐XhoI‐R | TAGACTCGAGCTGGTCTTGAGACCCGGTCT
pcDNA3.1‐F | CTAGAGAACCCACTGCTTAC
pcDNA3.1‐R | TAGACTCGAGCTGGTCTTGAGACCCGGTCT
pcMINI‐C‐F | ACTTAAGCTTatgagtgggctttggggtggccggtt
pcMINI‐C‐R | TAGAAGGCACAGTCGAGG

To corroborate the conclusions derived from this study, the assay was replicated using the same experimental protocol, using a pcMINI‐N vector that includes the universal Exon A‐intron A‐MCS sequence.

2.5. Cell Culture and Transfection

Human embryonic kidney (HEK293T) and HeLa cell lines (Cell Resource Center of the Chinese Academy of Medical Science, Beijing, China) were cultured at 37°C in a humidified 5% CO2 environment using Dulbecco′s modified Eagle medium supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. HEK293T and HeLa cells were transfected using the Lipo3000 transfection reagent (GlpBio Technology Inc., Montclair, California, United States). The transfected cells were incubated for 48 h before RNA extraction.

2.6. RNA Extraction, PCR, and Sequencing

Total RNA was isolated from HEK293T and HeLa cells transfected with the minigene plasmids using the GenElute Mammalian Total RNA Kit (Sigma‐Aldrich) as per the manufacturer′s instructions. DNA was subsequently removed from the RNA preparation through digestion with DNase I (Qiagen, Valencia, California, United States) on the columns. The purified total RNA was then reverse transcribed into cDNA, and a primer set was employed for the retro‐PCR targeting pcDNA3.1‐F/pcDNA3.1‐R (Table 2). Subsequently, the cDNA products were analyzed using 1% agarose gel electrophoresis and confirmed by Sanger sequencing. The lengths of the WT cDNA products were identified as 533 bp in the pcDNA3.1‐ENG vector and 635 bp in the pcMINI‐N‐ENG vector.

2.7. Western Blot Analysis

A plasmid expressing human ENG and another plasmid (p.Lys438_Gln476del‐ENG‐FLAG) containing the ENG bearing the same variant as the proband of Family 2 were obtained from Miaoling Bioscience (Wuhan, China). All the plasmids were confirmed by sequencing (Tsingke Biotechnology Co. Ltd, Beijing, China). Primer sequences for generating p.Lys438_Gln476del were as follows: D1 (forward): GTAGGCGTGTACGGTGGGAG and DR (reverse): gctgtttacactgaggacc. Equal amounts of the two types of plasmids were subsequently transiently transfected into HEK293T cells using Lipo2000 transfection reagent (GlpBio Technology Inc., Montclair, California, United States). After 48 h, cells were harvested using ice‐cold PBS and lysed in RIPA buffer with protease inhibitors (Tris‐HCl, 50 mM; Triton X‐100, 1%; deoxycholate, 1%; NaCl, 150 mM; and SDS, 10%). The protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, Massachusetts, United States). The cell lysates were separated on 10% Tris–glycine sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‐PAGE) gels. Subsequently, proteins were transferred to PVDF membranes. Monoclonal ANTI‐FLAG M2, Clone M2 (1:1000; Sigma‐Aldrich, St. Louis, Missouri, United States) was used for WB analysis according to standard protocols. The blot was incubated with goat antimouse IgG HRP secondary antibody (Biosharp, Hefei, Anhui, China), diluted 1:10000, at room temperature for 1 h. Afterwards, the blot was washed with tris‐buffered saline with Tween 20 (TBST), and finally, film exposure, development, and image capture were performed.